Review



10ul hrma reaction  (Bio-Rad)


Bioz Verified Symbol Bio-Rad is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 99
      Buy from Supplier

    Structured Review

    Bio-Rad 10ul hrma reaction
    Development of a Zebrafish CRISPR/Cas9 pipeline to assess functional impact of DMD modifier candidates . (A) Adult fish heterozygous for dmd are intercrossed to generate embryos for the screen. Because DMD in zebrafish follows an autosomal recessive inheritance pattern, one-quarter of the intercross progeny are homozygous dmd mutants ( dmd-/- ), all of which are identifiable using birefringence imaging by 4 dpf due to the presence of muscle lesions. Homozygous wild-type ( dmd+/+ ) and heterozygous dmd ( dmd+/- ) fish are indistinguishable. Embryos are injected by the 1-cell stage with modifier-targeting CRISPR and Cas9 protein or raised as uninjected controls. All fish are assayed for DMD onset between 2-4 dpf using live birefringence imaging. At 4 dpf, all fish are fixed, birefringence imaged, and genotyped via <t>HRMA.</t> (B, B’) Representative examples of wild-type (WT, top) and dmd-/- mutant (bottom) fish imaged via birefringence at 4 dpf. The boxes in B are shown magnified in B’. Wild-type fish show strong, uniform birefringence, whereas dmd mutant fish have variably-sized non-birefringence patches indicating dystrophic lesions (white arrows). Fish containing one or more lesion, regardless of lesion size or number, are scored as dystrophic in the onset assay.
    10ul Hrma Reaction, supplied by Bio-Rad, used in various techniques. Bioz Stars score: 99/100, based on 210 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/high+resolution+melting+analysis+hrma+%E2%80%A2+precision+melt+supermix/Precision+Melt+Supermix+for+High+Resolution+Melt+(HRM)+Analysis/bio_rxiv__2025__05__20__655139-239-21-24
    Average 99 stars, based on 210 article reviews
    10ul hrma reaction - by Bioz Stars, 2026-09
    99/100 stars

    Images

    1) Product Images from "Validation of Duchenne muscular dystrophy candidate modifiers using a CRISPR-Cas9-based approach in zebrafish"

    Article Title: Validation of Duchenne muscular dystrophy candidate modifiers using a CRISPR-Cas9-based approach in zebrafish

    Journal: bioRxiv

    doi: 10.1101/2025.05.20.655139

    Development of a Zebrafish CRISPR/Cas9 pipeline to assess functional impact of DMD modifier candidates . (A) Adult fish heterozygous for dmd are intercrossed to generate embryos for the screen. Because DMD in zebrafish follows an autosomal recessive inheritance pattern, one-quarter of the intercross progeny are homozygous dmd mutants ( dmd-/- ), all of which are identifiable using birefringence imaging by 4 dpf due to the presence of muscle lesions. Homozygous wild-type ( dmd+/+ ) and heterozygous dmd ( dmd+/- ) fish are indistinguishable. Embryos are injected by the 1-cell stage with modifier-targeting CRISPR and Cas9 protein or raised as uninjected controls. All fish are assayed for DMD onset between 2-4 dpf using live birefringence imaging. At 4 dpf, all fish are fixed, birefringence imaged, and genotyped via HRMA. (B, B’) Representative examples of wild-type (WT, top) and dmd-/- mutant (bottom) fish imaged via birefringence at 4 dpf. The boxes in B are shown magnified in B’. Wild-type fish show strong, uniform birefringence, whereas dmd mutant fish have variably-sized non-birefringence patches indicating dystrophic lesions (white arrows). Fish containing one or more lesion, regardless of lesion size or number, are scored as dystrophic in the onset assay.
    Figure Legend Snippet: Development of a Zebrafish CRISPR/Cas9 pipeline to assess functional impact of DMD modifier candidates . (A) Adult fish heterozygous for dmd are intercrossed to generate embryos for the screen. Because DMD in zebrafish follows an autosomal recessive inheritance pattern, one-quarter of the intercross progeny are homozygous dmd mutants ( dmd-/- ), all of which are identifiable using birefringence imaging by 4 dpf due to the presence of muscle lesions. Homozygous wild-type ( dmd+/+ ) and heterozygous dmd ( dmd+/- ) fish are indistinguishable. Embryos are injected by the 1-cell stage with modifier-targeting CRISPR and Cas9 protein or raised as uninjected controls. All fish are assayed for DMD onset between 2-4 dpf using live birefringence imaging. At 4 dpf, all fish are fixed, birefringence imaged, and genotyped via HRMA. (B, B’) Representative examples of wild-type (WT, top) and dmd-/- mutant (bottom) fish imaged via birefringence at 4 dpf. The boxes in B are shown magnified in B’. Wild-type fish show strong, uniform birefringence, whereas dmd mutant fish have variably-sized non-birefringence patches indicating dystrophic lesions (white arrows). Fish containing one or more lesion, regardless of lesion size or number, are scored as dystrophic in the onset assay.

    Techniques Used: CRISPR, Functional Assay, Imaging, Injection, Mutagenesis

    Related Articles

    Polymerase Chain Reaction:

    Article Title: Efficient visual screening of CRISPR/Cas9 genome editing in the nematode Pristionchus pacificus.
    Article Snippet: • Worm Pick: Platinum wire (Nilaco, PT- 351265, φ0.20 mm) connected to a Pasteur pipette (IWAKI GLASS, IK- PAS- 5P) • Inverted microscope for injection (Nikon, Eclipse TE300) • InjectMan® 4 (Eppendorf, 5192000027) • FemtoJet® 4i (Eppendorf, 5252000021) • Injection needles: Glass capillary with filament (NARISHIGE, GD- 1) • Needle puller (NARISHIGE, PC- 100) • Fluorescence Microscope (ZEISS, Discovery.V20) • Stereo microscope (Nikon, SMZ745) • Pristionchus pacificus, PS312 2.2 | Heteroduplex Mobility Assay (HMA) • KOD One PCR Master Mix (TOYOBO, KMM- 101) • Primers. a. Ppa- ser- 1: Forward, 5 -́ TGGGGAAGATAAAATAGCTCCA GTC- 3 ;́ Reverse, 5 -́ GACGCTCATGTGAACGATAGAAGC- 3ʹ b. ppa_stranded_DN26871_c0_g1_i2: Forward, 5 -́ GCACAATCC GCG TTGGTTG- 3 ;́ Reverse, 5 -́ TTCTAGTAGTATACTGCCGAC GTC- 3ʹ • MultiNA DNA- 500 kit (Shimadzu, 292– 27910– 91) • SYBR Gold (Life Technologies, S- 11494) • pUC19 DNA/MspI Marker (ThermoFisher, SM0221) • Proteinase K (Takara Bio, 9034) • 1× Worm Lysis Buffer: Tris (10 mM), KCl (50 mM), MgCl2・6H2O (2.5 mM), NonidetTM P- 40 (0.45%), Tween 20 (0.45%), and DDW. .. • MultiNA (Shimadzu, MCE- 202) • 96- well PCR plate, semi- skirted, flat deck (Shimadzu, GLC- 96SSFD- C) • PCR foil seal (Shimadzu, GLC- PS) 2.3 | High- Resolution Melting Analysis (HRMA) • Precision Melt Supermix (Bio- Rad, #172- 5110) • Primers a. Ppa- daf- 2 (cbh64): Forward, 5 -́ CCCTTCCCTTGATCTTTC TTT- 3 ;́ Reverse; 5 -́ CTTGTACTTGTCCATCTCCG- 3ʹ b. Ppa- daf- 2 (cbh66): Forward, 5 -́ GAATATCCATCATCTTCCT GTTCC- 3 ;́ Reverse, 5 -́ CTTCCTCCCTTCTACTCACCAT- 3ʹ • Proteinase K (Takara Bio, 9034) • 1× Worm Lysis Buffer In this protocol, we use Bio- Rad equipment, but other equipment can also be used. .. • Real- time PCR analysis system (Bio- Rad, CFX ConnectTM, 1855201J1) • Hard- Shell PCR Plate 96- Well, thin- wall (Bio- Rad, HSP9655) • Optical Flat 8- Cap Strips for 0.2 ml tube strips/plates (Bio- Rad, TCS0803) • Bio- Rad CFX manager Software 3.1 • Bio- Rad Precision Melt Analysis Software 1.3 (Bio- Rad, 1845025JA) 3 | PROCEDURE 3.1 | Design of crRNA and repair template for HDR For CRISPR/Cas9 genome editing, designing a gRNA that guides the Cas9 protein to the target site is necessary. gRNA is designed using nloaded from https://onlinelibrary.w iley.com /doi/10.1111/dgd.12761 by N guyen T am - T aipei M edical U niversity , W iley O nline L ibrary on [25/02/2024].

    Lysis:

    Article Title: Efficient visual screening of CRISPR/Cas9 genome editing in the nematode Pristionchus pacificus.
    Article Snippet: • Worm Pick: Platinum wire (Nilaco, PT- 351265, φ0.20 mm) connected to a Pasteur pipette (IWAKI GLASS, IK- PAS- 5P) • Inverted microscope for injection (Nikon, Eclipse TE300) • InjectMan® 4 (Eppendorf, 5192000027) • FemtoJet® 4i (Eppendorf, 5252000021) • Injection needles: Glass capillary with filament (NARISHIGE, GD- 1) • Needle puller (NARISHIGE, PC- 100) • Fluorescence Microscope (ZEISS, Discovery.V20) • Stereo microscope (Nikon, SMZ745) • Pristionchus pacificus, PS312 2.2 | Heteroduplex Mobility Assay (HMA) • KOD One PCR Master Mix (TOYOBO, KMM- 101) • Primers. a. Ppa- ser- 1: Forward, 5 -́ TGGGGAAGATAAAATAGCTCCA GTC- 3 ;́ Reverse, 5 -́ GACGCTCATGTGAACGATAGAAGC- 3ʹ b. ppa_stranded_DN26871_c0_g1_i2: Forward, 5 -́ GCACAATCC GCG TTGGTTG- 3 ;́ Reverse, 5 -́ TTCTAGTAGTATACTGCCGAC GTC- 3ʹ • MultiNA DNA- 500 kit (Shimadzu, 292– 27910– 91) • SYBR Gold (Life Technologies, S- 11494) • pUC19 DNA/MspI Marker (ThermoFisher, SM0221) • Proteinase K (Takara Bio, 9034) • 1× Worm Lysis Buffer: Tris (10 mM), KCl (50 mM), MgCl2・6H2O (2.5 mM), NonidetTM P- 40 (0.45%), Tween 20 (0.45%), and DDW. .. • MultiNA (Shimadzu, MCE- 202) • 96- well PCR plate, semi- skirted, flat deck (Shimadzu, GLC- 96SSFD- C) • PCR foil seal (Shimadzu, GLC- PS) 2.3 | High- Resolution Melting Analysis (HRMA) • Precision Melt Supermix (Bio- Rad, #172- 5110) • Primers a. Ppa- daf- 2 (cbh64): Forward, 5 -́ CCCTTCCCTTGATCTTTC TTT- 3 ;́ Reverse; 5 -́ CTTGTACTTGTCCATCTCCG- 3ʹ b. Ppa- daf- 2 (cbh66): Forward, 5 -́ GAATATCCATCATCTTCCT GTTCC- 3 ;́ Reverse, 5 -́ CTTCCTCCCTTCTACTCACCAT- 3ʹ • Proteinase K (Takara Bio, 9034) • 1× Worm Lysis Buffer In this protocol, we use Bio- Rad equipment, but other equipment can also be used. .. • Real- time PCR analysis system (Bio- Rad, CFX ConnectTM, 1855201J1) • Hard- Shell PCR Plate 96- Well, thin- wall (Bio- Rad, HSP9655) • Optical Flat 8- Cap Strips for 0.2 ml tube strips/plates (Bio- Rad, TCS0803) • Bio- Rad CFX manager Software 3.1 • Bio- Rad Precision Melt Analysis Software 1.3 (Bio- Rad, 1845025JA) 3 | PROCEDURE 3.1 | Design of crRNA and repair template for HDR For CRISPR/Cas9 genome editing, designing a gRNA that guides the Cas9 protein to the target site is necessary. gRNA is designed using nloaded from https://onlinelibrary.w iley.com /doi/10.1111/dgd.12761 by N guyen T am - T aipei M edical U niversity , W iley O nline L ibrary on [25/02/2024].



    Similar Products

    10ul hrma reaction  (Bio-Rad)
    99
    Bio-Rad 10ul hrma reaction
    Development of a Zebrafish CRISPR/Cas9 pipeline to assess functional impact of DMD modifier candidates . (A) Adult fish heterozygous for dmd are intercrossed to generate embryos for the screen. Because DMD in zebrafish follows an autosomal recessive inheritance pattern, one-quarter of the intercross progeny are homozygous dmd mutants ( dmd-/- ), all of which are identifiable using birefringence imaging by 4 dpf due to the presence of muscle lesions. Homozygous wild-type ( dmd+/+ ) and heterozygous dmd ( dmd+/- ) fish are indistinguishable. Embryos are injected by the 1-cell stage with modifier-targeting CRISPR and Cas9 protein or raised as uninjected controls. All fish are assayed for DMD onset between 2-4 dpf using live birefringence imaging. At 4 dpf, all fish are fixed, birefringence imaged, and genotyped via <t>HRMA.</t> (B, B’) Representative examples of wild-type (WT, top) and dmd-/- mutant (bottom) fish imaged via birefringence at 4 dpf. The boxes in B are shown magnified in B’. Wild-type fish show strong, uniform birefringence, whereas dmd mutant fish have variably-sized non-birefringence patches indicating dystrophic lesions (white arrows). Fish containing one or more lesion, regardless of lesion size or number, are scored as dystrophic in the onset assay.
    10ul Hrma Reaction, supplied by Bio-Rad, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/high+resolution+melting+analysis+hrma+%E2%80%A2+precision+melt+supermix/Precision+Melt+Supermix+for+High+Resolution+Melt+(HRM)+Analysis/bio_rxiv__2025__05__20__655139-239-21-24
    Average 99 stars, based on 1 article reviews
    10ul hrma reaction - by Bioz Stars, 2026-09
    99/100 stars
    		  Buy from Supplier
    precision melt supermix for hrma  (Bio-Rad)
    99
    Bio-Rad precision melt supermix for hrma
    Development of a Zebrafish CRISPR/Cas9 pipeline to assess functional impact of DMD modifier candidates . (A) Adult fish heterozygous for dmd are intercrossed to generate embryos for the screen. Because DMD in zebrafish follows an autosomal recessive inheritance pattern, one-quarter of the intercross progeny are homozygous dmd mutants ( dmd-/- ), all of which are identifiable using birefringence imaging by 4 dpf due to the presence of muscle lesions. Homozygous wild-type ( dmd+/+ ) and heterozygous dmd ( dmd+/- ) fish are indistinguishable. Embryos are injected by the 1-cell stage with modifier-targeting CRISPR and Cas9 protein or raised as uninjected controls. All fish are assayed for DMD onset between 2-4 dpf using live birefringence imaging. At 4 dpf, all fish are fixed, birefringence imaged, and genotyped via <t>HRMA.</t> (B, B’) Representative examples of wild-type (WT, top) and dmd-/- mutant (bottom) fish imaged via birefringence at 4 dpf. The boxes in B are shown magnified in B’. Wild-type fish show strong, uniform birefringence, whereas dmd mutant fish have variably-sized non-birefringence patches indicating dystrophic lesions (white arrows). Fish containing one or more lesion, regardless of lesion size or number, are scored as dystrophic in the onset assay.
    Precision Melt Supermix For Hrma, supplied by Bio-Rad, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/high+resolution+melting+analysis+hrma+%E2%80%A2+precision+melt+supermix/Precision+Melt+Supermix+for+High+Resolution+Melt+(HRM)+Analysis/10__7554_slash_elife__86066-402-0-5
    Average 99 stars, based on 1 article reviews
    precision melt supermix for hrma - by Bioz Stars, 2026-09
    99/100 stars
    		  Buy from Supplier
    high resolution melting analysis hrma • precision melt supermix  (Bio-Rad)
    99
    Bio-Rad high resolution melting analysis hrma • precision melt supermix
    Development of a Zebrafish CRISPR/Cas9 pipeline to assess functional impact of DMD modifier candidates . (A) Adult fish heterozygous for dmd are intercrossed to generate embryos for the screen. Because DMD in zebrafish follows an autosomal recessive inheritance pattern, one-quarter of the intercross progeny are homozygous dmd mutants ( dmd-/- ), all of which are identifiable using birefringence imaging by 4 dpf due to the presence of muscle lesions. Homozygous wild-type ( dmd+/+ ) and heterozygous dmd ( dmd+/- ) fish are indistinguishable. Embryos are injected by the 1-cell stage with modifier-targeting CRISPR and Cas9 protein or raised as uninjected controls. All fish are assayed for DMD onset between 2-4 dpf using live birefringence imaging. At 4 dpf, all fish are fixed, birefringence imaged, and genotyped via <t>HRMA.</t> (B, B’) Representative examples of wild-type (WT, top) and dmd-/- mutant (bottom) fish imaged via birefringence at 4 dpf. The boxes in B are shown magnified in B’. Wild-type fish show strong, uniform birefringence, whereas dmd mutant fish have variably-sized non-birefringence patches indicating dystrophic lesions (white arrows). Fish containing one or more lesion, regardless of lesion size or number, are scored as dystrophic in the onset assay.
    High Resolution Melting Analysis Hrma • Precision Melt Supermix, supplied by Bio-Rad, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/high+resolution+melting+analysis+hrma+%E2%80%A2+precision+melt+supermix/Precision+Melt+Supermix+for+High+Resolution+Melt+(HRM)+Analysis/pm34813661-77-27-36
    Average 99 stars, based on 1 article reviews
    high resolution melting analysis hrma • precision melt supermix - by Bioz Stars, 2026-09
    99/100 stars
    		  Buy from Supplier
    high resolution melt analysis hrma  (Bio-Rad)
    99
    Bio-Rad high resolution melt analysis hrma
    Development of a Zebrafish CRISPR/Cas9 pipeline to assess functional impact of DMD modifier candidates . (A) Adult fish heterozygous for dmd are intercrossed to generate embryos for the screen. Because DMD in zebrafish follows an autosomal recessive inheritance pattern, one-quarter of the intercross progeny are homozygous dmd mutants ( dmd-/- ), all of which are identifiable using birefringence imaging by 4 dpf due to the presence of muscle lesions. Homozygous wild-type ( dmd+/+ ) and heterozygous dmd ( dmd+/- ) fish are indistinguishable. Embryos are injected by the 1-cell stage with modifier-targeting CRISPR and Cas9 protein or raised as uninjected controls. All fish are assayed for DMD onset between 2-4 dpf using live birefringence imaging. At 4 dpf, all fish are fixed, birefringence imaged, and genotyped via <t>HRMA.</t> (B, B’) Representative examples of wild-type (WT, top) and dmd-/- mutant (bottom) fish imaged via birefringence at 4 dpf. The boxes in B are shown magnified in B’. Wild-type fish show strong, uniform birefringence, whereas dmd mutant fish have variably-sized non-birefringence patches indicating dystrophic lesions (white arrows). Fish containing one or more lesion, regardless of lesion size or number, are scored as dystrophic in the onset assay.
    High Resolution Melt Analysis Hrma, supplied by Bio-Rad, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/high+resolution+melting+analysis+hrma+%E2%80%A2+precision+melt+supermix/Precision+Melt+Supermix+for+High+Resolution+Melt+(HRM)+Analysis/pmc06677535-184-4-11
    Average 99 stars, based on 1 article reviews
    high resolution melt analysis hrma - by Bioz Stars, 2026-09
    99/100 stars
    		  Buy from Supplier

    Image Search Results


    Development of a Zebrafish CRISPR/Cas9 pipeline to assess functional impact of DMD modifier candidates . (A) Adult fish heterozygous for dmd are intercrossed to generate embryos for the screen. Because DMD in zebrafish follows an autosomal recessive inheritance pattern, one-quarter of the intercross progeny are homozygous dmd mutants ( dmd-/- ), all of which are identifiable using birefringence imaging by 4 dpf due to the presence of muscle lesions. Homozygous wild-type ( dmd+/+ ) and heterozygous dmd ( dmd+/- ) fish are indistinguishable. Embryos are injected by the 1-cell stage with modifier-targeting CRISPR and Cas9 protein or raised as uninjected controls. All fish are assayed for DMD onset between 2-4 dpf using live birefringence imaging. At 4 dpf, all fish are fixed, birefringence imaged, and genotyped via HRMA. (B, B’) Representative examples of wild-type (WT, top) and dmd-/- mutant (bottom) fish imaged via birefringence at 4 dpf. The boxes in B are shown magnified in B’. Wild-type fish show strong, uniform birefringence, whereas dmd mutant fish have variably-sized non-birefringence patches indicating dystrophic lesions (white arrows). Fish containing one or more lesion, regardless of lesion size or number, are scored as dystrophic in the onset assay.

    Journal: bioRxiv

    Article Title: Validation of Duchenne muscular dystrophy candidate modifiers using a CRISPR-Cas9-based approach in zebrafish

    doi: 10.1101/2025.05.20.655139

    Figure Lengend Snippet: Development of a Zebrafish CRISPR/Cas9 pipeline to assess functional impact of DMD modifier candidates . (A) Adult fish heterozygous for dmd are intercrossed to generate embryos for the screen. Because DMD in zebrafish follows an autosomal recessive inheritance pattern, one-quarter of the intercross progeny are homozygous dmd mutants ( dmd-/- ), all of which are identifiable using birefringence imaging by 4 dpf due to the presence of muscle lesions. Homozygous wild-type ( dmd+/+ ) and heterozygous dmd ( dmd+/- ) fish are indistinguishable. Embryos are injected by the 1-cell stage with modifier-targeting CRISPR and Cas9 protein or raised as uninjected controls. All fish are assayed for DMD onset between 2-4 dpf using live birefringence imaging. At 4 dpf, all fish are fixed, birefringence imaged, and genotyped via HRMA. (B, B’) Representative examples of wild-type (WT, top) and dmd-/- mutant (bottom) fish imaged via birefringence at 4 dpf. The boxes in B are shown magnified in B’. Wild-type fish show strong, uniform birefringence, whereas dmd mutant fish have variably-sized non-birefringence patches indicating dystrophic lesions (white arrows). Fish containing one or more lesion, regardless of lesion size or number, are scored as dystrophic in the onset assay.

    Article Snippet: DNA was extracted from adult fin tissue or whole larvae as described above and 1ul was used as template in a 10ul HRMA reaction (BioRad 172-5112) in a CFX Duet Real-Time PCR System (#12016265) and analyzed using BioRad Precision Melt Analysis Software.

    Techniques: CRISPR, Functional Assay, Imaging, Injection, Mutagenesis